View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11635_low_76 (Length: 239)
Name: NF11635_low_76
Description: NF11635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11635_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 98 - 220
Target Start/End: Complemental strand, 5719798 - 5719676
Alignment:
| Q |
98 |
cccttcattattcatatatctccaaatgttattctatgttttttgttcctcttacaatcaatgagactcccaaaaaagtccaatcccagaaactnnnnnn |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5719798 |
cccttcattattcatatatctccaaatgttattctatgttttttgttcctcttacaatcaatgagactcccaaaaaagtccaatcccagaaactaaaaaa |
5719699 |
T |
|
| Q |
198 |
ntaaagttactccaatcaactta |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5719698 |
ataaagttactccaatcaactta |
5719676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 5719895 - 5719862
Alignment:
| Q |
1 |
gcaaattgaaaggtgcttgcttgctccatcaatg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5719895 |
gcaaattgaaaggtgcttgcttgctccatcaatg |
5719862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University