View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11636_high_24 (Length: 220)
Name: NF11636_high_24
Description: NF11636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11636_high_24 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 37669008 - 37669227
Alignment:
| Q |
1 |
agaataatgttgtctacttcaatggaagaattatataattgcatacctcgtaaaaccaaagagctgcaaaatgttattcatggttggaaaagttataagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37669008 |
agaataatgttgtctacttcaatggaagaattatataattgcatacctcgtaaaaccaaagagctgcaaaatgttattcatggttggaaaagttataagc |
37669107 |
T |
|
| Q |
101 |
aaagnnnnnnnaagttcttttttacttatgcaagatttaataattgattaattatataaataatgtgggggcttctttggacccaatcaaatcagttaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37669108 |
aaagtttttttaagttcttttttacttatgcaagatttaataattgattaattatataaataatgtgggggcttctttggacccaatcaaatcagttaaa |
37669207 |
T |
|
| Q |
201 |
ctcattcacttgattgctta |
220 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
37669208 |
ctcattcactttattgctta |
37669227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University