View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11636_low_17 (Length: 361)
Name: NF11636_low_17
Description: NF11636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11636_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 300
Target Start/End: Original strand, 29049351 - 29049634
Alignment:
| Q |
17 |
attttttcgtgccaagggacaaaaaacatggtagtggaggaaggcctaaccgcacaactgaaaaaggtttctggaaagccaccggttcggaccggaaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29049351 |
attttttcgtgccaagggacaaaaaacatggtagtggaggaaggcctaaccgcacaactgaaaaaggtttctggaaagccaccggttcggaccggaaaat |
29049450 |
T |
 |
| Q |
117 |
cgtgacgttatcggatccgaaacgcataattgggttgaggaagacgttggttttctatgagggaagagctccaagaggaaccaagactgattgggttatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29049451 |
cgtgacgttatcggatccgaaacgcataattgggttgaggaagacgttggttttctatgagggaagagctccaagaggaaccaagactgattgggttatg |
29049550 |
T |
 |
| Q |
217 |
aatgaataccgtttacctgacaatagccccttacctaaggtattgtgtatatatctttcttcatttgaatttgaactatatata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29049551 |
aatgaataccgtttacctgacaatagccccttgcctaaggtattgtgtatatatctttcttcatttgaatttgaactatatata |
29049634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 29037215 - 29037326
Alignment:
| Q |
17 |
attttttcgtgccaagggacaaaaaacatggtagtggaggaaggcctaaccgcacaactgaaaaaggtttctggaaagccaccggttcggaccggaaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29037215 |
attttttcgtgccaagggacaaaaaacatggtagtggaggaaggcctaaccgcacaactgaaaaaggtttctggaaagccaccggttcggaccggaaaat |
29037314 |
T |
 |
| Q |
117 |
cgtgacgttatc |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29037315 |
cgtgacgttatc |
29037326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University