View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11636_low_24 (Length: 238)
Name: NF11636_low_24
Description: NF11636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11636_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 8354917 - 8354681
Alignment:
| Q |
2 |
agatagactagggtgtatttttgaactgagtctcttacaacaacaaaaacaaaacagttatccatgatatatctat------------cattcccaaagc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
8354917 |
agatagactagggtgtatttttgaactgagtct--tacaacaacaaaaacaaaacagttatccatgatatatatatatatatatatatcattcccaaagc |
8354820 |
T |
 |
| Q |
90 |
aaaaggttttaggtt-----gcaggggaagcattagcaatgtcaatgacaaaacggtaacgaacatcattcttcacaagacgctgaaaagcttcattgat |
184 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8354819 |
aaagggttttaggttaggttgcaggggaagcattagcaatgtcaatgacaaaacggtaacgaacatcattcttcaaaagacgctgaaaagcttcattgat |
8354720 |
T |
 |
| Q |
185 |
tgtatcagctttgattaattcaatgtcacatgtgatatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8354719 |
tgtatcagctttgattaattcaatgtcacatgtgatatt |
8354681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University