View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11638_high_4 (Length: 269)
Name: NF11638_high_4
Description: NF11638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11638_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 255
Target Start/End: Original strand, 40005079 - 40005324
Alignment:
| Q |
10 |
gcacagatgggaagaaacacgaaaattgttacatcaactacaatgacatgttggaagagcaatgtgttatcctctcctggtctatacttttgaatattat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40005079 |
gcacagatgggaagaaacacgaaaattgttacatcaactacaatgacatgttggaagagcaatatgttatcctctcctggtctacacttttgaatattat |
40005178 |
T |
 |
| Q |
110 |
agttgcagattttgtttttatacaagagcatcgtagaacttgtataaatcttgaaaattatgcttatgcaattttgaaagtatttgatcattatggtttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005179 |
agttgcagattttgtttttatacaagagcatcgtagaacttgtataaatcttgaaaattatgcttatgcaattttgaaagtatttgatcattatggtttc |
40005278 |
T |
 |
| Q |
210 |
tagatccatgaatgtcatgtctcctaggtataccaatgttgtgttt |
255 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
40005279 |
tagatccatgaatgtcatgtctcctagatatatcaatgttgtgttt |
40005324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University