View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11638_high_5 (Length: 212)
Name: NF11638_high_5
Description: NF11638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11638_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 38 - 193
Target Start/End: Complemental strand, 47099830 - 47099675
Alignment:
| Q |
38 |
cttgtgtgtccaagatgtgtgtttcatcaaggattatgtttagctaaaaatcaaggtgttttgaaactagaagtgcaaattgacccagctgtgattgtta |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47099830 |
cttgtgtgtccaagatgtgtgtttcatcaaggattatgtttagctaaaaatcaaggtgttttgaaactagaagtgcaaattgacccagctgtgattgtta |
47099731 |
T |
 |
| Q |
138 |
gaagagaagggagtacagcaggttggcctctcataaacaaaattaaggctatcctt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47099730 |
gaagagaagggagtacagcaggttggcctctcataaacaaaattaaggctatcctt |
47099675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 47100205 - 47100259
Alignment:
| Q |
1 |
accttgatatagtcccgtcaactcagccatataagcacttgtgtgtccaagatgt |
55 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47100205 |
accttgatatagtcccgtcaactcggccatataagcacttgtgtgtccaagatgt |
47100259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University