View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11638_low_4 (Length: 362)
Name: NF11638_low_4
Description: NF11638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11638_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 345
Target Start/End: Original strand, 9115443 - 9115770
Alignment:
| Q |
18 |
atctcaattgtttgctatatctacccaaaactgacaagaatttccatggctatgcatgagagaaatttgttctctagcacctaacacaaccacttaacta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9115443 |
atctcaattgtttgctatatctacccaaaactgacaagaatttccatggctatgcatgagagaaatttgttctctagtacctaacacaaccacttaacta |
9115542 |
T |
|
| Q |
118 |
aagcacttttatacaaaatagaacaaatgcaactataattacaatccaaagttatcagaatttaaagcagcagccaaatgaccaaccctaaacccattat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9115543 |
aagcacttttatacaaaatagaacaaatgcaactataattacaatccaaagttatcagaatttaaagcagcagccaaatgaccaaccctaaacccattat |
9115642 |
T |
|
| Q |
218 |
taatccccacataatcatccctacaattatatgctttcacatgtcgagcttcaaatcccataaactttttaggacaaaaagactcagctgaaaaatgtga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9115643 |
taatccccacataatcatccctacaattatatgctttcacatgtcgagcttcaaatcccataaactttttaggacaaaaagactcaactgaaaaatgtga |
9115742 |
T |
|
| Q |
318 |
agatgcttttatagttgcaactgcattg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9115743 |
agatgcttttatagttgcaactgcattg |
9115770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University