View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11640_high_17 (Length: 245)
Name: NF11640_high_17
Description: NF11640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11640_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 3965456 - 3965671
Alignment:
| Q |
19 |
agatatgagtattaatttattcatctaacggttgagatgttggactgatgtacataaaacaaaaaggtgaccccacattattctttatttatttgcttct |
118 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3965456 |
agatatgagtgttaatttatttatctaacggttgagatgttggactgatgtacataaaacaaaaaggtgaccccacattattcgttatttatttgcttct |
3965555 |
T |
|
| Q |
119 |
gacttatcatcattaaatattaggttacataacaaatcaattgcattagtta--atacgtagttaaatcaatccctaattaattgttttgtttccatttc |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3965556 |
gacttatcatcattaattattaggttacataacaaattaattgcattagttaatatacgtagttaaatcaatccc----taattgttttgtttccatttc |
3965651 |
T |
|
| Q |
217 |
ttttatccgtccatctctgc |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3965652 |
ttttatccgtccatctctgc |
3965671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University