View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11640_high_19 (Length: 211)

Name: NF11640_high_19
Description: NF11640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11640_high_19
NF11640_high_19
[»] chr3 (2 HSPs)
chr3 (49-195)||(30409299-30409443)
chr3 (92-138)||(30411848-30411898)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 49 - 195
Target Start/End: Original strand, 30409299 - 30409443
Alignment:
49 cataatgtgatgtatgtattttgatattcaaataacgcaacactttattgtgtttagagtttagatgttttcttttaactcaaattcaaagggggcttag 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
30409299 cataatgtgatgtatgtattttgatattcaaataacgcaacactttattgtgtttagagtttagatgttttcttttaactcaaattcaaa--gggcttag 30409396  T
149 cttaacgaaaaccatacacttcccattcccaactagtcagtctgtgc 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
30409397 cttaacgaaaaccatacacttcccattcccaactagtcagtctgtgc 30409443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 138
Target Start/End: Original strand, 30411848 - 30411898
Alignment:
92 tttattgtgtttagagtttagatgttttc----ttttaactcaaattcaaa 138  Q
    |||||||| ||||||||||||||||||||    ||||||||||||||||||    
30411848 tttattgtatttagagtttagatgttttctatattttaactcaaattcaaa 30411898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University