View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11640_low_20 (Length: 240)
Name: NF11640_low_20
Description: NF11640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11640_low_20 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 31045564 - 31045787
Alignment:
| Q |
17 |
atcatcttactagagagagcatgtgagacacctatccctatatatagtaactatttgaaccaaaattttctgatttatatatgaatattttgacaattca |
116 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31045564 |
atcatcttactagagagatcatgtgcgacacctatccctatatatagtaactatttgaaccaaaattttctgatttatatatgaatatttcgacaattca |
31045663 |
T |
 |
| Q |
117 |
taggaattgctttaaatttgcatcggggacacatagttgatagtagaatatatatgagtatctaatttttagtgtgatggcattgttaatcactttacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045664 |
taggaattgctttaaatttgcatcggggacacatagttgatagtagaatatatatgagtatctaatttttagtgtgatggcattgttaatcactttacca |
31045763 |
T |
 |
| Q |
217 |
aatgcccacacaactcactctatc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31045764 |
aatgcccacacaactcactctatc |
31045787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 130
Target Start/End: Complemental strand, 171925 - 171884
Alignment:
| Q |
89 |
atttatatatgaatattttgacaattcataggaattgcttta |
130 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
171925 |
atttttatatgaatattttgacaattcataggaattgtttta |
171884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University