View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11640_low_21 (Length: 211)
Name: NF11640_low_21
Description: NF11640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11640_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 49 - 195
Target Start/End: Original strand, 30409299 - 30409443
Alignment:
| Q |
49 |
cataatgtgatgtatgtattttgatattcaaataacgcaacactttattgtgtttagagtttagatgttttcttttaactcaaattcaaagggggcttag |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30409299 |
cataatgtgatgtatgtattttgatattcaaataacgcaacactttattgtgtttagagtttagatgttttcttttaactcaaattcaaa--gggcttag |
30409396 |
T |
 |
| Q |
149 |
cttaacgaaaaccatacacttcccattcccaactagtcagtctgtgc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409397 |
cttaacgaaaaccatacacttcccattcccaactagtcagtctgtgc |
30409443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 138
Target Start/End: Original strand, 30411848 - 30411898
Alignment:
| Q |
92 |
tttattgtgtttagagtttagatgttttc----ttttaactcaaattcaaa |
138 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30411848 |
tttattgtatttagagtttagatgttttctatattttaactcaaattcaaa |
30411898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University