View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11641_high_29 (Length: 203)
Name: NF11641_high_29
Description: NF11641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11641_high_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 21643601 - 21643803
Alignment:
| Q |
1 |
ttttttacatgtgtttgtgccctagggttgaacgctaacatttttcggacatcagacacacatttaatcggatttactgaaaaatcttttgatattgttt |
100 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||| | || ||||||| |||||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
21643601 |
ttttttacatgtgttggtgcattagggttgaatgctaaaacttgtcggacaccagacacatattcaatcagatttactgaaaaatcttttgatattgttt |
21643700 |
T |
 |
| Q |
101 |
gcagctatcagcttcaaaagtatagaaatgcaggttcatttgttctaccagtagatccaaaagacaaagaaacatggggtgatagtgaacacagactagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21643701 |
gcagctatcagcttcaaaagtatagaaatgcaggctcatttgttctaccagtagatccaaaagacaaagaaacatggggtgatagtgaacacagactagc |
21643800 |
T |
 |
| Q |
201 |
cta |
203 |
Q |
| |
|
||| |
|
|
| T |
21643801 |
cta |
21643803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University