View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11641_low_24 (Length: 249)
Name: NF11641_low_24
Description: NF11641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11641_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 3277519 - 3277737
Alignment:
| Q |
12 |
agatggacatcacttgactatgtcgctacgcacagctgaaatgataacttttagtccaagaaaggaatgccatcattatttagtaatgcataatgctggt |
111 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3277519 |
agatggacatgacttgattatgtcgctacgcacagctgaaatgataacttttagtccaagaaaggaatgccatcattatttagtaatgcataatgctggt |
3277618 |
T |
|
| Q |
112 |
ttactaaatgtgaaaaaatcgatgtattcatcactatcattagtttagtaaaacaaattttgtattcaggggctatggctgaatgccagaacctatggta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3277619 |
ttactaaatgtgaaaaaatcgatgtattcatcactatcattagtttagtaaaacaaattttgtattcaggggctatggctgaatgccagaacctatggta |
3277718 |
T |
|
| Q |
212 |
tcaatacaagcatcctatt |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3277719 |
tcaatacaagcatcctatt |
3277737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University