View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11643_high_14 (Length: 269)

Name: NF11643_high_14
Description: NF11643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11643_high_14
NF11643_high_14
[»] chr5 (1 HSPs)
chr5 (18-262)||(41126115-41126359)


Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 41126115 - 41126359
Alignment:
18 cagtaacctccatgaaaatcgtctgcaacccattgtcagcagatccatgcaaaaatatcttcaaccccttttcggtatcatcaactttggaaaccttaga 117  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41126115 cagtaacctccatgaaaattgtctgcaacccattgtcagcagatccatgcaaaaatatcttcaaccccttttcggtatcatcaactttggaaaccttaga 41126214  T
118 agcgccccatttaaacggtagaacagagaaacacacgggttcgccatcgttatcttcgagatgataattggttacatacaaagactgaaactcgatttca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41126215 agcgccccatttaaacggtagaacagagaaacacacgggttcgccatcgttatcttcgagatgataattggttacatacaaagactgaaactcgatttca 41126314  T
218 gattcagtttcatcccttaatgtcgtgaatttccttttcatctca 262  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
41126315 gattcagtttcatcccttaatgtcgtgaatttccttttcatctca 41126359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University