View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11643_high_17 (Length: 250)
Name: NF11643_high_17
Description: NF11643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11643_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 11 - 247
Target Start/End: Complemental strand, 3700793 - 3700554
Alignment:
| Q |
11 |
cacagacaaaccagacccaacctaaaagatgttatacttatttcaagacaaggttaacaactaacatctaccccacatatatg-nnnnnnnngacctata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3700793 |
cacagacaaaccagacccaacctaaaagatgttatacttatttcaagacaagcttaacaactaacatctaccccacatatatgttcttttttgacctata |
3700694 |
T |
 |
| Q |
110 |
tgatacaaacttaatccatacatgatggatattttattgttgctgca--nnnnnnngacttaattcaaacaactacaaagtgtgtgtttgatttcgggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3700693 |
tgatacaaacttaatccatacatgatggatgttttattgttgctgcatttttttttgacttaattcaaacatctacaaagtgtgtgtttgatttcgggat |
3700594 |
T |
 |
| Q |
208 |
tgcaacacacaaaaatatgtttgcatactttccgatgcgt |
247 |
Q |
| |
|
||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
3700593 |
tgcaacacacaaaaacacgtttgcatactttctgatgcgt |
3700554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University