View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11643_high_8 (Length: 353)
Name: NF11643_high_8
Description: NF11643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11643_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 346
Target Start/End: Complemental strand, 55365138 - 55364810
Alignment:
| Q |
18 |
aggacaattaccacaagtgattgcacaagcactttataaccaatccaaattctccggccttcaaatgtctcaagatgttggaggctcttcccagttgcat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55365138 |
aggacaattaccacaggtgattgcacaagcactttataaccaatccaaattctccggccttcaaatgtctcaagatgttggaggctcttcccagttgcat |
55365039 |
T |
|
| Q |
118 |
ccaactcaacaggcatcatcactaagtgctgccatcaccgcggatccaaacttcacggcagcactcgcagctgctatctcctccataattggtgctgctc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55365038 |
ccaactcaacaggcatcatcactaagtgccgccatcaccgcggatccaaacttcacggcagcactcgcagctgctatctcctccataattggtgctgctc |
55364939 |
T |
|
| Q |
218 |
ctcccagcaacaataacagtaatcccaatatcatcaacagtgctacctacaatcagtagcatatttttcaggaagctagaagctcttcggttctataagt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
55364938 |
ctcccagcaacaataacagtaatcccaatatcatcaacagtgctacctacaatcagtagcatatttttcaggaagctaaaagctcttgggttctataagt |
55364839 |
T |
|
| Q |
318 |
ctgtttggcaagagagcttatggcctatg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55364838 |
ctgtttggcaagagagcttatggcctatg |
55364810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University