View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11643_low_11 (Length: 324)
Name: NF11643_low_11
Description: NF11643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11643_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 55 - 274
Target Start/End: Complemental strand, 45652115 - 45651875
Alignment:
| Q |
55 |
gagagctagtgatattctcaatatttttcttaaaatgataccctttgaacggggaagatcacaccacaaaatttaacataatttttccttgtgttcagac |
154 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45652115 |
gagagctactgatattctcaatatttt-cttaaaatgataccctttgaacggggaagatcacaccacaaaatttaacataattttaccttgtgttcagac |
45652017 |
T |
 |
| Q |
155 |
tgatctacaaccccgtctcttgcggcccacttttataa----------------------ccacttgataacgtctctatgaattgagtttatcttccaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45652016 |
tgatctacaaccccgtctcttgcggcccacttttataaatggaccgacttcataaccaatccacttgataacgtctctatggattgagtttatcttccaa |
45651917 |
T |
 |
| Q |
233 |
cagccaccacactaagccattgaagtgcccttctcaacaatt |
274 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
45651916 |
cagccaccacactaagccattgaagggcaattctcaacaatt |
45651875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 45652171 - 45652131
Alignment:
| Q |
18 |
caaaccaagtcaatatgcctagtaattgtttcccaaagaga |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652171 |
caaaccaagtcaatatgcctagtaattgtttcccaaagaga |
45652131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 274 - 305
Target Start/End: Complemental strand, 45651860 - 45651829
Alignment:
| Q |
274 |
tgcaagggcttcttcctaaaagtataaatacc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45651860 |
tgcaagggcttcttcctaaaagtataaatacc |
45651829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University