View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11643_low_9 (Length: 350)
Name: NF11643_low_9
Description: NF11643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11643_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 20 - 276
Target Start/End: Complemental strand, 6614993 - 6614745
Alignment:
| Q |
20 |
cgattcgctccattcggtcagcctcatcaacggtcctcctttgaattttcatacctacgcggctacgccactcttattcatgatattaaggacttgatca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6614993 |
cgattcgctccattcggtcagcctcatcaacggtccacctttgaattttcatacctacgc--------cactcttattcatgatattaaggacttgatca |
6614902 |
T |
 |
| Q |
120 |
ttctcatcagttcttctatttttcatactcttcggaaggggaatcattgcgccaattttctagctaaaatgggagcggctacggatgttgttttgacttt |
219 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6614901 |
ttctcatcggttcttctatttttcatactcttcgggaggagaatcattgcgccgattttctagctaaaatgggagcggctacggatgttgttttgacttt |
6614802 |
T |
 |
| Q |
220 |
tcatgtttctgcactagaagagatgttaccgcttattagggaagatgcttgtggaac |
276 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6614801 |
tcatgcttctgcaccagaagagatgttaccgcttattagggaagatgcctgtggaac |
6614745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University