View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11644_high_12 (Length: 408)
Name: NF11644_high_12
Description: NF11644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11644_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 2e-96; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 208 - 390
Target Start/End: Original strand, 6564789 - 6564971
Alignment:
| Q |
208 |
gttggtcttacccttcggccccgaggaaatggactctcgtaatttggatatgataagtaaagactggtcaaagattattcatgccatagtctaaacttgc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564789 |
gttggtcttacccttcggccccgaggaaatggactctcgtaatttggatatgataagtaaagactggtcaaagattattcatgccatagtctaaacttgc |
6564888 |
T |
 |
| Q |
308 |
gtactcgtggtcaatttgattttcaccgaaactcatggactacttaagtctaaccacttggttttgaatataggcttctcatg |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564889 |
gtactcgtggtcaatttgattttcaccgaaactcatcgactacttaagtctaaccacttggttttgaatataggcttctcatg |
6564971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 27 - 87
Target Start/End: Original strand, 6564595 - 6564655
Alignment:
| Q |
27 |
agcagagagcacaccactcttcaggtaatcaatcaaacttccttcaaaaaacggcaaacta |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564595 |
agcagagagcacaccactcttcaggtaatcaatcaaacttccttcaaaaaacggcaaacta |
6564655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 150 - 193
Target Start/End: Original strand, 6564718 - 6564761
Alignment:
| Q |
150 |
ggtttgattgtaaggtcttaagaaacaaatgaccatttaaggtt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564718 |
ggtttgattgtaaggtcttaagaaacaaatgaccatttaaggtt |
6564761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University