View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_15 (Length: 432)
Name: NF11645_high_15
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 13 - 180
Target Start/End: Original strand, 49623875 - 49624042
Alignment:
| Q |
13 |
agcaaaggtgtaataaaggcagaaagtttggtcgacgttgggaatcccttggacctgaaaaaacgtaaagggatgaaagagatttgagaaagagaagaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623875 |
agcaaaggtgtaataaaggcagaaagtttggtcgacgttgggaatcccttggacctgaaaaaacgtaaagggatgaaagagatttgagaaagagaagaaa |
49623974 |
T |
 |
| Q |
113 |
acaagaataaaggtgtgaactagagagataaaggttacctcacgatgacctagttcggcgagaacagc |
180 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623975 |
acaagaataacggtgtgaactagagagataaaggttacctcacgatgacctagttcggcgagaacagc |
49624042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 227 - 419
Target Start/End: Original strand, 49624089 - 49624280
Alignment:
| Q |
227 |
gatttataaacagccatgatttatcttttggaggattggatacaagtgaagaatgggacttgtagtcgtatagaaaagctgttatacgttttaggggttg |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49624089 |
gatttataaacagccatgatttatcttttggaggattggatataagtgaagaatgggacttgtagtcgtatagaaaagctgttatacgttttaggggtta |
49624188 |
T |
 |
| Q |
327 |
gggttttttatttccttaaaccgtaaagcagtttnnnnnnntaccttttcttcattgttcgacttacgtaaattttgccctaatttccagaag |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49624189 |
gggttttttatttccttaaaccgtaaagcag-ttaaaaaaataccttttcttcattgttcgacttacgtaaattttgccctaatttccagaag |
49624280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University