View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_33 (Length: 315)
Name: NF11645_high_33
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 15635723 - 15635437
Alignment:
| Q |
20 |
agtagaaccagaatggaagagatttggaccattgatgatgttatgtttaatgtacctggactctccatggatcatttcattcctcctgctgatattcttg |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15635723 |
agtagaaccaggatggaagagatttggaccattgatgatgttatgtttaatgtacctggactctccatggatcatttcattcctcctgctgatattcttg |
15635624 |
T |
|
| Q |
120 |
acaatataaattctccatgataataaaaaataatgacgcagtgtattgggaaatcaacataggtagtagcattagggttttattaacnnnnnnnnnnnna |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||| | |
|
|
| T |
15635623 |
acaatataaattctccatgataataaaaaataatgatgcagtgtattgggagatcaacataggtagtagcattaggtttttattaac--tttttttttta |
15635526 |
T |
|
| Q |
220 |
cttttaaaggtaatgtgaattgtaactttactttggagggggtataattaaagtattggtggggggtgtaatcttttttgtctctgctt |
308 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15635525 |
cttttaaaggcaatgtgaattgtaactttactttggagggggtataattaaagtattggtggggggtgtaatcttttttgtctttgctt |
15635437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University