View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11645_high_53 (Length: 249)

Name: NF11645_high_53
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11645_high_53
NF11645_high_53
[»] chr4 (1 HSPs)
chr4 (1-231)||(36275084-36275311)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 36275311 - 36275084
Alignment:
1 ttactgtgatcaaagcgtctaagtcttcgtttgggagttgatacttggctgttatgttgctcatacctgcacacgatcatgaattgaagagataagagaa 100  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36275311 ttaccgtgatcaacgcgtctaagtcttcgtttgggagttgatacttggctgttatgttgctcatacctgcacacgatcatgaattgaagagataagagaa 36275212  T
101 acaatttcttagagaaaagggaaaaggtgaggggttttgaaattcttattaccggagagtttagagagtttatggacaagagcggagaaggagatggagc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||    
36275211 acaatttcttagagaaaagggaaaaggtgaggggttttgaaattc---ttaccggagagtttagagagtttatggacaagagcggagaaggagatggagc 36275115  T
201 ggttgacggcgacgatacgggtgtctccgcc 231  Q
    |||||||||||||||||||||||||||||||    
36275114 ggttgacggcgacgatacgggtgtctccgcc 36275084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University