View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_55 (Length: 246)
Name: NF11645_high_55
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 44814788 - 44815025
Alignment:
| Q |
1 |
ccttttaaagtagcatgagcaatccgaggaccagccatttcgttccttgtctttaagcttgttaattctgtaggttacaaaaatattgcaaatataaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44814788 |
ccttttaaagtagcatgagcaatccgaggaccagccatttcgttccttgtcttcaagcttgttaattctgtaggttacaaaaatattgcaaatataaaac |
44814887 |
T |
|
| Q |
101 |
caggaagcagtttaaacttcaaaatgcagaccaatcctattnnnnnnnntctgattctagggaatgcaggggagtaaataaacgaaaagcgcaacaaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44814888 |
caggaagcagtttaaacttcaaaatgcagaccaatcctattaaaaaaaaagtgattctagggaatgcaggggagtaaataaacgaaaagcgcaacaaata |
44814987 |
T |
|
| Q |
201 |
ataacagagnnnnnnnaggcggttttttaaccttcttc |
238 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |
|
|
| T |
44814988 |
ataacagagtttttttaggcggtttttcaaccttcttc |
44815025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University