View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_56 (Length: 244)
Name: NF11645_high_56
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 46540398 - 46540572
Alignment:
| Q |
1 |
tatgatgtatattatgtgaagcataagaagaacatcttgatttccaatgatagtatgctgtgatttttaggaagcacaaaatgtgtgtttggttgagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46540398 |
tatgatgtatattatgtgaagcataaga---acatcttgatttccaatgatagtatgctgtgatttttaggaagcacaaaatgtgtgtttggttgagtat |
46540494 |
T |
|
| Q |
101 |
attggaaaataacagcgtacttttttgaagctagaaaatgtaattgttgtaaaattattgcgactcatcgtgatcatgt |
179 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46540495 |
attggaaaataacagcgtacttttgtgaagctagaaaatgtaattgttgtaaaa-tattgcgactcatcgtgatcatgt |
46540572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 46540614 - 46540655
Alignment:
| Q |
179 |
tatgtatatgcacagattctaacttctgcatggacatgcagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46540614 |
tatgtatatgcacagattctaacttctgcatggacatgcagt |
46540655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University