View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_60 (Length: 240)
Name: NF11645_high_60
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 29094459 - 29094244
Alignment:
| Q |
18 |
gaagatatgtcaaggagaatggttaggtttcctaagcttacagccatggtggaaaagagagaagaaagaaggttttgaatattgaaaaggaagaggtgaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29094459 |
gaagatatgtcaaggagtatggttaggtttcctaagcttacagccatggtggaaaagagagaagaaagaaggttttgaatattgaaaaggaagaggtgaa |
29094360 |
T |
 |
| Q |
118 |
gatattttatgtggttgtagtaacttgtaaggaagaagatggctatgggatctttgtcggttttacagtaacgtggagatgtgtagtccagtgacgtgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
29094359 |
gatattttatgtggttgtagtaacttgtaaggaagaagatggctatgggatctttgtcggttttgcagtaacgtggaaatgtgtaggccagtgacgtgtg |
29094260 |
T |
 |
| Q |
218 |
gcaccttctctcatcg |
233 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
29094259 |
gcaccttctatcatcg |
29094244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University