View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_63 (Length: 237)
Name: NF11645_high_63
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_63 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 31405062 - 31404826
Alignment:
| Q |
1 |
catcagtgcagccatatgtctgtggttttggaatctcttgttccctgacaaatctccttatttgagaatgaaattctttgaaaacaaattacctcatgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31405062 |
catcagtgcagccatatgtctgtggttttggaatctcttgttccctgacaaatctccttatttgagaatgaaattctttgaaaacaaattacctcatgtc |
31404963 |
T |
|
| Q |
101 |
attttaatttttacaatgccttgtaatattcagtatagtttctgaagattcataaatgtctagtatatatcgattcttgttctgttttttgtgattacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31404962 |
attttaatttttacaatgccttgtaatattcagtctagtttctgaagattcataaatgtccagtatatatcgattcttgttctgttttctgtgattacca |
31404863 |
T |
|
| Q |
201 |
gatattcatagatagtttttgcaaattaattcaggga |
237 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31404862 |
gagattcatagatagtttttgcaaattaattcaggga |
31404826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 77 - 141
Target Start/End: Original strand, 31332304 - 31332368
Alignment:
| Q |
77 |
tttgaaaacaaattacctcatgtcattttaatttttacaatgccttgtaatattcagtatagttt |
141 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||||||| | |||||| ||| |||||| |
|
|
| T |
31332304 |
tttgaaaacaaattaccttattttattttaatttttacaatgcctagcaatatttagtctagttt |
31332368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University