View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_64 (Length: 237)
Name: NF11645_high_64
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_64 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 205
Target Start/End: Original strand, 7519 - 7720
Alignment:
| Q |
4 |
atttaaagagtgtcccaaatcaagaacattcattagaagaccctttttaaaactctattgatctaatcatttctcaaccgtggcaagtatgacaagagca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7519 |
atttaaagagtgtcccaaatcaagaacactcattagaagaccctttttaaaactctatcgatctaatcatttctcaaccgtggcaagtatgacaagagca |
7618 |
T |
 |
| Q |
104 |
atgttattgagccacatcatcttatgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataacagatttatttgtcatcatga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7619 |
atgttattgagccacatcatcttatgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataatagatttatttgtcatcatga |
7718 |
T |
 |
| Q |
204 |
ta |
205 |
Q |
| |
|
|| |
|
|
| T |
7719 |
ta |
7720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University