View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_65 (Length: 236)
Name: NF11645_high_65
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 46126329 - 46126111
Alignment:
| Q |
1 |
acggccaagaagcaaggaaagatagctagtgaggtcaagctgctgctttgtgcccttcatgagccagtcttaaagctgacaagtaatagcacaatcaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126329 |
acggccaagaagcaaggaaagatagctagtgaggtcaagctgctgctttgtgcccttcatgagccagtcttaaagctgacaagtaatagcacaatcaaga |
46126230 |
T |
|
| Q |
101 |
aagacatgatgagcagtttcagcagtcttattgcagaagcagcaaatggagactatgatgcaacccctttttcttaaaaattctcatcggtggggagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
46126229 |
aagacatgatgagcagtttcagcagtcttgttgcagaagcagcaaatggagactatgatgcaacccctttttctt--aaattctcatcagtggggagttt |
46126132 |
T |
|
| Q |
201 |
attctgaagcaatctccaagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46126131 |
attctgaagcaatctccaagt |
46126111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University