View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_67 (Length: 233)
Name: NF11645_high_67
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 34077238 - 34077016
Alignment:
| Q |
1 |
cctaaggttcattctgtgattgctgttgctaaaccacgtttggcaagtcatatgtatgattgatctaagggcaatatcaatgttctataaacaagttgaa |
100 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34077238 |
cctaaggttcatcctttgattgctgttgctaaaccacgtttggcaagtcatatgtatgattgatttaagggcaatatcaatgttctataaacaagttgaa |
34077139 |
T |
 |
| Q |
101 |
taaaaaatcatctataattaattattttcttgcaatttcaagaaccgcaaatgataatctatagtagaatttctcttgatggctgtcaattgtcatgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
34077138 |
taaaaaatcatctataattaattattttcttgcaatttcaagaaccgcaaatgataatctatagtagaatttctcttgatggttgtcaattgt-----ca |
34077044 |
T |
 |
| Q |
201 |
tgcatgctagtcaattaagctcatagca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34077043 |
tgcatgctagtcaattaagctcatagca |
34077016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University