View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_high_8 (Length: 500)
Name: NF11645_high_8
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_high_8 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 9 - 70
Target Start/End: Complemental strand, 9060 - 8999
Alignment:
| Q |
9 |
gagatgaagcttgccgttcgcggtggaaaaatcagaggagagagaatttggcaatttttttg |
70 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9060 |
gagaagaagcttgccgttcgcggtggaaaaatcagaggagagagaatttggcaatttttttg |
8999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University