View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_21 (Length: 387)
Name: NF11645_low_21
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 12 - 181
Target Start/End: Complemental strand, 38060157 - 38059988
Alignment:
| Q |
12 |
acagacctacatcatcaagattctcaaggacaaaatttattgcatatctctttcggagaacacaagccattatgaacaataactaactagaaatatcact |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38060157 |
acagacttacatcatcaagattctcaaggacaaaatttattgcatatctcttttggagaacacaagccattatgaacaataactaactagaaatatcact |
38060058 |
T |
|
| Q |
112 |
aaaactatcatgatgtgcgtagaatcagttgactattatgcgttagtgaatggtgatattgttggtccta |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38060057 |
aaaactatcatgatgtgcgtagaatccgttgactattatgcgttagtgaatggtgatattgttggtccta |
38059988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 228 - 370
Target Start/End: Complemental strand, 38059988 - 38059845
Alignment:
| Q |
228 |
aaaaatcttatttaaaaattgcttttagcttaaattgggtcatgcagttttttaagaattaacttgatcgagacaa-nnnnnnnagccggatcggttgga |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38059988 |
aaaaatcttatttaaaaattgcttttagcttaaattgggtcatgcagttttttaagaattaacttgatcgagacaattttttttagccggatcggttgga |
38059889 |
T |
|
| Q |
327 |
caactttttcgagttatcaaaggtttgaattagtactactcgtg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38059888 |
caactttttcgagttatcaaaggtttgaattagtactactcgtg |
38059845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University