View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_30 (Length: 319)
Name: NF11645_low_30
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 39 - 311
Target Start/End: Original strand, 10595402 - 10595674
Alignment:
| Q |
39 |
aattgacatcaatcttgttattaatggtgcannnnnnnggctgcagagtttgtgctataataactttccaagatcagccagtgaaaatctagttctgtct |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595402 |
aattgacatcaatcttgttattaatggtgcatttttttggatgcagagtttgtgctataataactttccaagatcagccagtgaaaatctagttctgtct |
10595501 |
T |
 |
| Q |
139 |
gttcttggtaacctttccaaacaaacatgattcctggatacagaaacatggactcatacccatttcaaagaaaccaaataccattccctcattaccatca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || || |
|
|
| T |
10595502 |
gttcttggtaacctttccaaacaaacatgattcctggatacagaaacatggactcatacccatttcaaagaaaccaaataccattcccttattatcacca |
10595601 |
T |
 |
| Q |
239 |
tcctggcattgaacttgttcctcctcaaatgaccaaatcacccttcccttatgaacaaccttggccctatgct |
311 |
Q |
| |
|
||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10595602 |
tccaagcatggaacctgttcctcctcaaatgaccaaatcacccttcccttatgaacaaccttggccttatgct |
10595674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University