View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_47 (Length: 254)
Name: NF11645_low_47
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 6839945 - 6839707
Alignment:
| Q |
15 |
caaagggatcaatgcattggaggacaggtttaatagatcatgaaacttgtaatttttatcaacaattttttatccattatgttgtaatactgtcataatt |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6839945 |
caaagggatcgatgcattggaggacaggtttaatagatcatgaaacttaaaaaaaaattcaacaattttttatccattatgttgtaatactgtcataatt |
6839846 |
T |
 |
| Q |
115 |
atcattacatacgcaagaacaatccatccttgcttgtcacaatatcctctataatcaatcacaacacacgacctgtaatttgtgctaaaactgtcattct |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6839845 |
atcattacatacacaagaacaatccatccttgcctgtcacaatatcctctataatcaatcacaacacacgacctgtaatttgtgctgaaactgtcattct |
6839746 |
T |
 |
| Q |
215 |
aaatacattttcttgataatttgcggtttgcgcattcttt |
254 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
6839745 |
aaatacattttcttgataatttgcag-ttgcgcattcttt |
6839707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University