View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_53 (Length: 249)
Name: NF11645_low_53
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 36275311 - 36275084
Alignment:
| Q |
1 |
ttactgtgatcaaagcgtctaagtcttcgtttgggagttgatacttggctgttatgttgctcatacctgcacacgatcatgaattgaagagataagagaa |
100 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275311 |
ttaccgtgatcaacgcgtctaagtcttcgtttgggagttgatacttggctgttatgttgctcatacctgcacacgatcatgaattgaagagataagagaa |
36275212 |
T |
 |
| Q |
101 |
acaatttcttagagaaaagggaaaaggtgaggggttttgaaattcttattaccggagagtttagagagtttatggacaagagcggagaaggagatggagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275211 |
acaatttcttagagaaaagggaaaaggtgaggggttttgaaattc---ttaccggagagtttagagagtttatggacaagagcggagaaggagatggagc |
36275115 |
T |
 |
| Q |
201 |
ggttgacggcgacgatacgggtgtctccgcc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36275114 |
ggttgacggcgacgatacgggtgtctccgcc |
36275084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University