View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_58 (Length: 241)
Name: NF11645_low_58
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_58 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 10049363 - 10049589
Alignment:
| Q |
19 |
gaagtttctggatggaaaatcgctggtaatgctggctgcgacgaacagatggttccaccgcgtgatcatggatgatgctatttggaagttcgtttgcttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10049363 |
gaagtttctggatggaaaatcgctggtaatgctggctgcgacgaaccgatggttccgccgcgtgatcatggatgatgtcatttggaagttcgtttgcttg |
10049462 |
T |
|
| Q |
119 |
cgtgatcttcaagttccatctcctccaactgtggcattcaagtggagcaacctctacacttcagcttttggtaagaaatagcacctacaccttcatcaa- |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10049463 |
cgtgatcttcaagttccatctcctccacctgtggcattcaagtggagcaacctctacacttcagcttttggtaagaaatagcacctacaccttcatcaat |
10049562 |
T |
|
| Q |
218 |
---tgtccatgagtggtactgctactg |
241 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
10049563 |
gtctgtccatgtgtggtactgctactg |
10049589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University