View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11645_low_64 (Length: 237)

Name: NF11645_low_64
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11645_low_64
NF11645_low_64
[»] scaffold0170 (1 HSPs)
scaffold0170 (4-205)||(7519-7720)


Alignment Details
Target: scaffold0170 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 205
Target Start/End: Original strand, 7519 - 7720
Alignment:
4 atttaaagagtgtcccaaatcaagaacattcattagaagaccctttttaaaactctattgatctaatcatttctcaaccgtggcaagtatgacaagagca 103  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
7519 atttaaagagtgtcccaaatcaagaacactcattagaagaccctttttaaaactctatcgatctaatcatttctcaaccgtggcaagtatgacaagagca 7618  T
104 atgttattgagccacatcatcttatgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataacagatttatttgtcatcatga 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
7619 atgttattgagccacatcatcttatgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataatagatttatttgtcatcatga 7718  T
204 ta 205  Q
    ||    
7719 ta 7720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University