View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_70 (Length: 228)
Name: NF11645_low_70
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_70 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 41265411 - 41265190
Alignment:
| Q |
7 |
cctgcaagtaacaaccaaaacacgaccgtttatccacctcatataaagtgaattacaattattgatgaatgagttaatgataatatttataaattatgag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
41265411 |
cctgcaagtaacaaccaaaacacgaccgtttatccacctcatataaagtgaattacaattattgatgaataagttaatgataatattgataaattatgag |
41265312 |
T |
|
| Q |
107 |
tgattgaaatatgaaccattccttctaaagaactagagcccctaaggtgtctatctttggatacgatagtgtttgtttacgtatcatttcagatttaaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41265311 |
tgattgaaatatgaaccattccttctaaagaactagagcccctaaagtgtctatctttggatacgatagtgtttgtttacgtatcatttcagatttaaac |
41265212 |
T |
|
| Q |
207 |
atatactagtataagtcaaaaa |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41265211 |
atatactagtataagtcaaaaa |
41265190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University