View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11645_low_72 (Length: 223)
Name: NF11645_low_72
Description: NF11645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11645_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 36568251 - 36568060
Alignment:
| Q |
18 |
agattatgttgatggtttgaaattttcaggaggttctgacagtttgatgccaaaagcatttatcaaacaagttattgatactgctcatcaccatgatgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568251 |
agattatgttgatggtttgaaattttcaggaggttctgacagtttgatgccaaaagcatttatcaaacaagttattgatactgctcatcaccatgatgtt |
36568152 |
T |
 |
| Q |
118 |
tatgttagcactggtgattgggctgaacatatcattcacaaaggtccttcaggattcaaagactatgtggaggtttcattttgccacctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568151 |
tatgttagcactggtgattgggctgaacatatcattcacaaaggtccttcaggattcaaagactatgtggaggtttcattttgccacctttg |
36568060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University