View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_high_26 (Length: 336)
Name: NF11646_high_26
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 88 - 303
Target Start/End: Original strand, 32173899 - 32174114
Alignment:
| Q |
88 |
cagaggacaatgcacacgtaatggtacaatgatactgtgtgagtgtgataagatattaacttgtttaattggcaagat-aaaaagtgattccattttgta |
186 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32173899 |
cagaggacaatgcacacgtaatgggacaatgatactgtgtgagtgtgataagatattaacttgtttaattggcaagataaaaaagtgattccattttgta |
32173998 |
T |
|
| Q |
187 |
gtgtttggcattttgtcaaattggattctccttaaaaagaagtcaaatataaaaatggatttagttatgatttgataactaattgtagtgaatttttggt |
286 |
Q |
| |
|
|||||||||||||||| ||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32173999 |
gtgtttggcattttgtaaaaat-gattcttcttaaaaacaagtcaaatataaaaatagatttagttatgatttgataactaattgtagtgcatgtttggt |
32174097 |
T |
|
| Q |
287 |
tttgcgtttccgttgcc |
303 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
32174098 |
tttgcctttccgttgcc |
32174114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University