View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_high_41 (Length: 251)
Name: NF11646_high_41
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14221895 - 14222138
Alignment:
| Q |
1 |
aagttttaaatgttaagttgtctttttgtgaacttttgtgtgtagtatattgtgttgattagtttataaacacgcaggaaaatccacagtatggaaagtt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14221895 |
aagttttaaatattaagttgtctttttgtgaacttttgtgtgtagtatattgtgttgattagtttataaacacgcaggaaaatccacagtatggaaagtt |
14221994 |
T |
 |
| Q |
101 |
taggcaaaagggacttccattttacattgaattaactactttgttcaaggatatggttgatactagacaggttgcattggtaccctcttctgggatacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14221995 |
taggcaaaagggacttccattttacattgaattaactactttgttcaaggatatggttgatactagacaggttgcattggtaccctcttctgggatacca |
14222094 |
T |
 |
| Q |
201 |
cctaatggcacagatgaaaataacgatgtgcatcgcctatgctt |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14222095 |
cctaatggcacagatgaaaataacaatgtgcatcgcctatgctt |
14222138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University