View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_high_45 (Length: 244)
Name: NF11646_high_45
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_high_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 11631796 - 11632020
Alignment:
| Q |
20 |
gttcccattatcctatggaagctttgtttcccacccccaaccccaatgttcataaatacctcaattctcnnnnnnnnnnnnnggacaaaattactcttct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11631796 |
gttcccattatcctatggaagctttgtttcccacccccaaccccaatgttcataaatacctcaattctcttttttctttttttgacaaaattactcttct |
11631895 |
T |
 |
| Q |
120 |
tttcaagtaggcttgcagatggaatttgtctgaaagtatatttttgaacatgttttgttttatttttggcgtaattccgatatcctccgcacgcaacttg |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11631896 |
tttcaagtaggcttgcagatggaatatgtctgaaagtatatttttgaacatgttttgttttatttttggcgtaattccgatatcctccgcacgcaacttg |
11631995 |
T |
 |
| Q |
220 |
cggagagtaatatctcgagtcttac |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11631996 |
cggagagtaatatctcgagtcttac |
11632020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 200 - 243
Target Start/End: Complemental strand, 25739239 - 25739196
Alignment:
| Q |
200 |
tatcctccgcacgcaacttgcggagagtaatatctcgagtctta |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
25739239 |
tatcctccgcacgcaacttgcggagactaatttatcgagtctta |
25739196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 34946529 - 34946489
Alignment:
| Q |
202 |
tcctccgcacgcaacttgcggagagtaatatctcgagtctt |
242 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
34946529 |
tcctccgctcgcaacttgcggagactaatttctcgagtctt |
34946489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University