View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11646_high_54 (Length: 223)

Name: NF11646_high_54
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11646_high_54
NF11646_high_54
[»] chr6 (1 HSPs)
chr6 (18-208)||(33870374-33870564)


Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 33870564 - 33870374
Alignment:
18 ctatgtaacatcctttaaatgttatattcaaatagttttggaaaatgtcccatgactcattttgcagaactttcattgtactcattttgcaagttcttat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
33870564 ctatgtaacatcctttaaatgttatattcaaatagttttggaaaatgtcccatgactcattttgcaaaactttcattgtactcattttgcaagttcttat 33870465  T
118 caatgatttctacatctggctttccagcacaatgtcgaaccctctcaacttcaatataaagaaaattccacataatttgtcgcgcttcttc 208  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
33870464 caatgatttctacatttggctttccagcacaatgtcgaaccctctcaacttcaatataaagaaaatttcacataatttgtcgcgcttcttc 33870374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University