View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_24 (Length: 371)
Name: NF11646_low_24
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 2353775 - 2353648
Alignment:
| Q |
18 |
cagaacaacgaaattgacagaaggaagcataaaaatttacagaagatagcataaaattatgtaaacaacatcaaattaatatgatcttgagccttcaaaa |
117 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2353775 |
cagaataacgaaattgacagaaggaaacataaaaatttgcagaagatagcataaaattatgtaaacaacatcaaattaatatgatcctgagccttcaaaa |
2353676 |
T |
 |
| Q |
118 |
tatcagtgtcgagagtttaaaataacaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2353675 |
tatcagtgtcgagagtttaaaataacaa |
2353648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 263 - 351
Target Start/End: Complemental strand, 2353594 - 2353506
Alignment:
| Q |
263 |
ctgagtcgcttggtctgcaatacctacgtaattcttccatctaagccttaatcgataatggatggcaggatctgtttcagtcacaatcc |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2353594 |
ctgagtcgcttggtctgcaatacctacgtaattcttccatctaagccttaatcgataatggatggcaggatctgtttcagtcacaatcc |
2353506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University