View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_38 (Length: 284)
Name: NF11646_low_38
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 6 - 265
Target Start/End: Complemental strand, 38578260 - 38578001
Alignment:
| Q |
6 |
aggagcagagatatatcagcagttgctagctaaatttaaagaaattattttgcaagcaaagggaaatgattccatgtcaagtgattttcactctaattat |
105 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38578260 |
aggaccagacatatatcagcagttgctagctaaatttaaagaaattattttgcaagcaaagggaaattattccatgtcaagtgattttcactctaattat |
38578161 |
T |
 |
| Q |
106 |
ttcaaaccttctcccacgtgtaatatttgatatttaccatcactaatatcatcatatatttgtctgaatgaatatggtgaccaggtctaaagacgtcaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38578160 |
ttcaaaccttctcccacgtgtaatatttgatatttaccatcactaatatcatcatatatttgtctgaatgaatatggtgacaaggtctaaagacgtcaat |
38578061 |
T |
 |
| Q |
206 |
taaatagcatatcccaatgataaggcatcttacaatgtggaagcatatgtttggtagaac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38578060 |
taaatagcatatcccaatgataaggcatcttacaatgtggaagcatatgtttggtagaac |
38578001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University