View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_42 (Length: 253)
Name: NF11646_low_42
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_42 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 2409811 - 2409559
Alignment:
| Q |
1 |
tcaagaatggatttcatttcctcattgtcacacaaggtgactgagaataaggtgaaagttgtcaaacctctttctaaggttgctgcaaccccaaaagcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409811 |
tcaagaatggatttcatttcctcattgtcacacaaggtgactgagaataaagtgaaagttgtcaaacctctttctaaggttgctgcaaccccaaaagcca |
2409712 |
T |
 |
| Q |
101 |
aggtgaagcaatcaccctccatgagtaaggctttgaccactccaaggaatcaaaagaaggtttctaatttggaacagtttagaagtgttcagaacaagaa |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409711 |
aggtgaagcaatcaccctccgtgagtaaggctttgaccactccaaggaatcaaaagaaggtttctaatttggaacagtttagaagtgttcagaacaagaa |
2409612 |
T |
 |
| Q |
201 |
atcattgactgttgctgtgtcgaagcctaagagcagggtagtggctaaggcat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409611 |
atcattgactgttgctgtgtcgaagcctaagagcagggtagtggctaaggcat |
2409559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University