View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_53 (Length: 239)
Name: NF11646_low_53
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 223
Target Start/End: Complemental strand, 7366827 - 7366632
Alignment:
| Q |
28 |
cacaatctaattttcagcaatttttcttaaaaaataatccctttatacaaaatgtaacctttttcaatcaaaacgaatccaattcttacatagatctaaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7366827 |
cacaatctaattttcagcaatttttcttaaaaaataatccctttatacaaaatgtaacctttttcaatcaaaacgaatccaattcttacatagatctaaa |
7366728 |
T |
|
| Q |
128 |
tctaactaatctaatccaatcatgcaacaaaggttgtcacaacaaaacataataaccttaaaaacatcaaaacaatgtgaatctcaaccatataac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7366727 |
tctaactaatctaatccaatcatgcaacaaaggttgtcacaacaaaacataataaccttaaaaacatcaaaacaatgtgaatctcaaccatttaac |
7366632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University