View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_54 (Length: 237)
Name: NF11646_low_54
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 4998289 - 4998502
Alignment:
| Q |
10 |
agcaaagggaatcgagaaactggttttagccggtaacaggttttccggtgagtttccggcaggagtctgtgaacatgttgagctagtgctaattgacatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4998289 |
agcaaagggaatcgagaaactggttttagccggtaacaggttttccggtgagtttccggcaggagtctgtgaacatgttgagctagtgctaattgacatt |
4998388 |
T |
 |
| Q |
110 |
ggaaataaccggtttactggtgaggtccctacctgcataaccggtttgaaaaagttgcagaagcttaaaatgcaagaaaacatgttcactggaaaaattc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4998389 |
ggaaataaccggtttactggtgaggtccctacctgcataaccggtttgaaaaagttgcagaagcttaaaatgcaagaaaacatgttcactggaaaaattc |
4998488 |
T |
 |
| Q |
210 |
ccggtaatgttact |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4998489 |
ccggtaatgttact |
4998502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University