View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_56 (Length: 223)
Name: NF11646_low_56
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 33870564 - 33870374
Alignment:
| Q |
18 |
ctatgtaacatcctttaaatgttatattcaaatagttttggaaaatgtcccatgactcattttgcagaactttcattgtactcattttgcaagttcttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33870564 |
ctatgtaacatcctttaaatgttatattcaaatagttttggaaaatgtcccatgactcattttgcaaaactttcattgtactcattttgcaagttcttat |
33870465 |
T |
 |
| Q |
118 |
caatgatttctacatctggctttccagcacaatgtcgaaccctctcaacttcaatataaagaaaattccacataatttgtcgcgcttcttc |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33870464 |
caatgatttctacatttggctttccagcacaatgtcgaaccctctcaacttcaatataaagaaaatttcacataatttgtcgcgcttcttc |
33870374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University