View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11646_low_9 (Length: 548)
Name: NF11646_low_9
Description: NF11646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11646_low_9 |
 | |
|
| [»] scaffold0071 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 7e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 7e-75
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 42600482 - 42600288
Alignment:
| Q |
1 |
gagagatgaatgatgccttaaatatcacaatagcaacacattacgtatgcatatttgaaatataaactttacttcatgcaaatattgtctcattcatatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42600482 |
gagagatgaatgatgccttaaatatcacaatag--acacattaagtatgcatatttgaaatctaaactttacttcatgcaaatattgtctcattcagatc |
42600385 |
T |
|
| Q |
101 |
aaaacttaaaccacctgtgctcttttc------tattgacatacattctaaaagtctatcaagtggtaacaaagccaccttagaaatgtcaactcct |
191 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600384 |
aaaatttaaaccacctgtgttcttttctattcttattgacatacattctaaaagtctatcaagtggtaacaaagccaccttagaaatgtcaactcct |
42600288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 176 - 309
Target Start/End: Complemental strand, 42600271 - 42600138
Alignment:
| Q |
176 |
agaaatgtcaactcctactactacttctgaaagagattggcgtaactgggttgaattgcatgatagccaaagatattgttgacattggtaaatttattaa |
275 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600271 |
agaaatgtcaacacctactactacttctgaaagagattggcgtaattgggttgaattgcatgatagccaaagatattgttgacattggtaaatttattaa |
42600172 |
T |
|
| Q |
276 |
ttttcagtttaacgaagatacttctaatatgttt |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
42600171 |
ttttcagtttaatgaagatacttctaatatgttt |
42600138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 297 - 328
Target Start/End: Original strand, 34594 - 34625
Alignment:
| Q |
297 |
ttctaatatgtttcaagttctctctcggccta |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34594 |
ttctaatatgtttcaagttctctctcggccta |
34625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 297 - 328
Target Start/End: Complemental strand, 15427644 - 15427613
Alignment:
| Q |
297 |
ttctaatatgtttcaagttctctctcggccta |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15427644 |
ttctaatatgtttcaagttctctctcggccta |
15427613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University