View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11647_high_16 (Length: 239)

Name: NF11647_high_16
Description: NF11647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11647_high_16
NF11647_high_16
[»] chr5 (1 HSPs)
chr5 (1-41)||(34821170-34821210)


Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 34821210 - 34821170
Alignment:
1 aagtaaacttgtgtgttttatatcatatttgtttccccttc 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
34821210 aagtaaacttgtgtgttttatatcatatttgtttccccttc 34821170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University